Інформація

Необхідність двох датчиків кисню в E. coli

Необхідність двох датчиків кисню в E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

кишкова паличка має два датчики кисню: FNR (фумарат-нітрат редуктаза) і ArcBA (безкисневий редокс-контроль, двокомпонентні системи контролю). FNR безпосередньо відчуває кисень, тоді як взаємодія ArcB з киснем є непрямою через пул хінонів. З трьох хіононів у кишкова паличка, який з них (окислені та відновлені форми всіх трьох типів) відіграє роль, наскільки в якому напрямку (гальмує/активує) є багато дискусійним. Я хотів би побачити кілька інтуїтивно зрозумілих аргументів на рівні, чому клітині, навіть в принципі, потрібно мати два датчики кисню?


Нерідкі випадки, коли клітини мають паралельні шляхи для однакового результату. Це забезпечує надійну відповідь і робить систему надійною. E.coli також має інший датчик для аеротаксису (білки Aer і Tsr). Дивіться мою відповідь у вашій попередній публікації та у статті за посиланням.

Також шукайте узгоджені мотиви мережі прямого зв’язку.


Зондування кисню та окислювально-відновного впливу двокомпонентними системами, які регулюють поведінкові реакції: поведінкові аналізи та структурні дослідження aer з використанням дисульфідного перехресного зшивання in vivo

Значне збільшення кількості анотованих датчиків аеротаксису (пошуку кисню) та окислювально-відновних датчиків можна пояснити останніми досягненнями в геноміці бактерій. Однак прогнози in silico повинні підкріплюватися поведінковими та генетичними аналізами, які підтверджують функцію аеротаксису або окислювально-відновного таксісу. У цій главі представлено набір процедур, які були дуже успішними для характеристики аеротаксису та окислювально-відновного таксі у Escherichia coli. Методи описані досить детально, щоб дозволити дослідникам інших видів адаптувати процедури для їх використання. Проточна газова комірка використовується для кількісного визначення тимчасових реакцій бактерій на ступеневе збільшення або зниження парціального тиску кисню або окислювально-відновного потенціалу. Аналіз поведінки бактерій у просторових градієнтах проводиться за допомогою оптично плоских капілярів та м’яких агарових пластин (сукцинатний агар або триптоновий агар). Ми описуємо два підходи для оцінки бажаного парціального тиску кисню, який приваблює бактеріальну різновид. Ця концентрація важлива для розуміння мікробної екології. На молекулярному рівні ми описуємо процедури, що використовуються для визначення структури та топології Aer, мембранного рецептора для аеротаксису. Цистеїновий скануючий мутагенез та процедури зшивання дисульфіду in vivo використовують окислювач Cu(II)-(1,10-фенантролін)(3) та біфункціональні сульфгідрил-реактивні зонди. Нарешті, ми опишемо методи, які використовуються для визначення меж трансмембранних сегментів рецепторів, таких як Aer. До них належать 5-йодоацетамідофлуоресцеїн, 4-ацетамідо-4-дисульфонова кислота, динатрієва сіль (AMS) і малеімід метоксиполіетиленгліколю, зонд молекулярної маси 5 кДа, який змінює рухливість Aer на SDS-PAGE.


Фон

Неінвазивне виявлення внутрішньоклітинного О2 має особливе значення, оскільки є одним із ключових метаболітів облігатних і факультативних аеробних організмів. Клітинний О2 є помітним індикатором метаболічної активності, що залежить від кисню, як-от аеробне дихання або залежний від кисню синтез і деградація клітинних компонентів [1, 2]. Крім того, О. контролює різні біологічні, патологічні та біотехнологічні процеси2 обмеження, включаючи утворення біоплівки та взаємодії хазяїна з патогеном [3–7], запальні процеси, спричинені гіпоксією [8], патофізіологію пухлин [9–12], а також процеси мікробної ферментації, що використовуються для біоремедіації та виробництва їжі, кормів та біопалива [ 13–16].

На сьогоднішній день різні малоінвазивні флуоресценції та фосфоресценції на основі O2- були розроблені чутливі зонди для візуалізації молекулярного кисню в клітинах і тканинах. Серед них барвники платини (II) -порфірину широко використовуються для аналізу реакцій клітин ссавців, спричинених гіпоксією [17–19]. Крім того, зелений флуоресцентний білок (GFP) та його варіанти можна застосовувати як генетично закодовані внутрішньоклітинні зонди, які специфічно експресуються та можуть бути селективно націлені на певні клітини та тканини. У цьому контексті було розроблено принаймні два «пасивних» датчика кисню на основі GFP для оцінки внутрішньоклітинних рівнів кисню в кишкова паличка. Тут GFP застосовували як репортерний білок, експресований під контролем реагування на кисень кишкова паличка промотори [20, 21]. Крім того, було застосовано фотоактивацію чутливого до кисню GFP-опосередкованої червоної флуоресценції в природних умовах візуалізація кисню в клітинах та органах ссавців [22–24].

Примітно, що молекулярний кисень наразі не можна аналізувати в природних умовах генетично закодованими біосенсорами на основі FRET, хоча ці біосенсори є одним із найпоширеніших класів флуоресцентних молекулярних зондів, що використовуються для неінвазивного кількісного аналізу внутрішньоклітинних сполук, включаючи Ca 2+ , Zn 2+ , Cl - , pH, H2О2, АТФ, мальтоза, сахароза, рибоза та глюкоза [25–27]. Що стосується кисневого датчика, GFP-подібні білки, які зазвичай використовуються як донорні та акцепторні домени біосенсорів FRET, мають серйозний недолік: їх автокаталітичний синтез хромофорів суворо залежить від присутності молекулярного кисню [28, 29] і, таким чином, інтенсивність сигналу флуоресценції в основному не відображає кількість синтезованого репортерного білка [30]. Таким чином, GFP та його кольорові варіанти не можуть використовуватися лише як флуоресцентні біосенсорні домени для точного O2 рішучість.

Нещодавно ми розробили новий клас флуоресцентних білків, які несуть флавінмононуклеотид (FMN) як хромофор [31]. На відміну від GFP-подібних FP, сигнал флуоресценції цих флуоресцентних білків на основі FMN (FbFP) не залежить від клітинного кисню, і, таким чином, FbFP можна використовувати як кількісний в природних умовах репортерний білок у режимі реального часу в аеробних та анаеробних умовах [30, 31]. Тут ми повідомляємо про конструкцію та застосування першого генетично закодованого біосенсора для кисню на основі FRET під назвою FluBO, який складається з нечутливого до кисню донорного домену FbFP та чутливого до гіпоксії посиленого жовтого флуоресцентного білка (YFP) акцепторного домену. Далі ми показуємо, що його ефективність FRET динамічно реагує на зміну O2 значення в живих бактеріальних клітинах.


Вступ

Ризобії-це альфа-протеобактерії, які вступають у симбіоз з рослинами бобових [1]. Бактерії перетворюють інертний атмосферний N2 в біологічно доступний аміак і надають його рослині-господарю в процесі, який називається азотфіксацією [2,3]. Вся біологічна фіксація каталізується ферментним комплексом нітрогенази, який еволюціонував перед Великою подією оксигенації і вимагає майже аноксичних умов для функціонування [4–6]. Однак ризобії є облігатними аеробами і повинні дихати, щоб задовольнити високі енергетичні потреби фіксації азоту [7,8]. Ці конкуруючі вимоги створюють «кисневий парадокс» у симбіотичній фіксації азоту [9,10]. Щоб подолати цей парадокс, розвинулася складна співпраця між ризобією та їх рослинами-партнерами (огляд у [11,12]). Бобові рослини містять кореневища у виділених кореневих бульбочках, які утворюються там, де бактерії проникли в корінь рослини, зазвичай через інфекційні нитки (огляд в [13,14]). Вузлики створюють майже безкисневе внутрішнє середовище, придатне для активності нітрогенази [15–17]. Для виробництва цього середовища кисень (О2) захоплюється і переміщається до бактероїдів за допомогою леггемоглобіну рослин [18–21]. Концентрація вільного О., що залишилася2 у центральній зоні азотфіксації конкрецій становить 20–50 нМ [22,23]. Ризобія зазнає радикальної зміни способу життя після проникнення вузликів, щоб вижити та фіксувати азот у цих умовах (огляд у [24,25]). У невизначених вузликах, таких як ті, що виробляються Pisum sativum (горох), ризобії спочатку вільно живуть при вході [26,27]. Потім вони зазнають незворотних змін способу життя, переміщаючись від верхівки вузлика до його ядра [28,29]. Починаючи з зони II і прискорюючи в міжзоні II-III, ризобії остаточно диференціюються на квазіорганели бактероїди, спеціалізовані для фіксації азоту [30,31]. У III зоні невизначених вузликів присутні диференційовані бактероїди, які активно фіксують азот [32]. Ризобіальні регуляторні механізми, чутливі до O2 напруження є необхідними для успішної диференціації на бактероїди та встановлення продуктивного симбіозу [33–35].

Кілька О2 сенсори розвинулися в ризобіях, три з яких широко поширені і часто співіснують в одному організмі [11,36]. Перший — це мембранно-зв’язаний білок FixL, який утворює двокомпонентну систему (TCS) з білком-приймачем FixJ (оглядається в [37,38]). У мікроаеробних умовах FixL фосфорилює FixJ, що, у свою чергу, індукує експресію fixK коефіцієнт транскрипції [39–41]. FixK індукує експресію нижчезазначених генів шляхом зв'язування як димеру з мотивом «анаеробокс» (TTGAT-N4-ATCAA) перед їхніми промоторами [42,43].

Другий поширений О.2 датчик є варіантом FixL, який називається гібридним FixL (hFixL) [44,45]. Це утворює альтернативну TCS з FxkR, що діє як білок -приймач. FxkR не є гомологом FixJ, але аналогічним чином індукує експресію fixK, шляхом прив’язування до мотиву «K-box» вгорі (GTTACA-N4-GTTACA) [46]. Третій О.2 датчик є фактором транскрипції FnrN. Як і FixK, FnrN зв’язує мотив анаеробокса як димер, і обидва є близькими гомологами Е. coli регулятор анаеробіозу FNR [47–49]. На відміну від FixK, але як і FNR, FnrN містить N-кінцевий багатий цистеїном кластер, який робить білок прямим датчиком O2 [50–53]. Відомо, що датчики FixL та hFixL активуються при відносно помірних мікроаеробних умовах, у тому числі у вільноживучих ризобіях [54–56]. FnrN, ймовірно, буде набагато менше O2 толерантний. О2 чутливість FnrN не була визначена, але Е. coli Гомолог FNR активний лише в анаеробних умовах [57–59]. Усі вивчені на сьогодні симбіотичні ризобії використовують принаймні один з цих трьох датчиків [11]. Ці датчики зазвичай співіснують, зокрема в Rhizobium leguminosarum біовар viciae VF39, кілька штамів Ensifer meliloti (раніше Sinorhizobium meliloti) і Rhizobium etli CFN42 [44,45,60–62].

Ще більше підкреслюючи важливість О2 регуляції в симбіотичній фіксації азоту, ризобії також використовують O2 визначення фактора транскрипції NifA для регулювання їх остаточної диференціації в азотфіксуючі бактероїди (огляди див. у [38,63]). Вважається, що чутливість до кисню NifA обумовлена ​​цистеїном, що зв’язує метали, у міждомному лінкері білка [64–66]. Білок має великий регулон, зокрема, включає компоненти нітрогенази, такі як nifH [67–70]. Вираз nifA зазвичай ригобія регулюється автоматично, часто через зчитування з вищого гена або оперону, регульованого NifA, у багатьох випадках fixABCX [69,71–73]. У Rlv3841, a fixABCX оперон знаходиться безпосередньо перед течією nifA, що пропонує такий механізм автоматичної активації NifA наскрізне. Зазвичай, ні вираз nifA а також активність білка безпосередньо регулюється трьома О2 датчики, описані вище [11]. Одним помітним винятком є Е. meliloti, де nifA регулюється системою FixLJ [74–76]. Немає доказів того, що FixK або FnrN безпосередньо регулює nifA вираз у Rlv3841.

Схоже, що серед ризобій існує певний спектр, де деякі види розділяють датчики кисню на окремі шляхи, тоді як у інших видів ці датчики частково або повністю об’єднані в комбінований ієрархічний шлях [77,78]. Там, де датчики кисню знаходяться в розділених шляхах, часто існує надмірність. У цих ситуаціях втрата одного датчика кисню не скасовує активності азотфіксації [79,80]. Навпаки, там, де датчики об’єднані в єдиний регуляторний шлях, деякі компоненти є індивідуально важливими [11]. Таким чином, втрата одного датчика кисню може серйозно погіршити фіксацію азоту, навіть якщо інші датчики залишаються.

в R. leguminosarum bv. VF39, нокаутуючи FnrN або hFixL, зменшив фіксацію азоту до 30% або 50% WT відповідно, що свідчить про неієрархічну, надлишкову структуру [60]. Шлях hFixL-FxkR-FixK R. etli CFN42 не можна використовувати як подвійний fixK мутант не впливав на азотфіксацію, тоді як подвійний fnrN мутант зменшив фіксацію до 20% від рівня WT. На відміну, R. etli Схоже, що CFN42 використовує складний ієрархічний шлях з безліччю гомологів FixK та FnrN, що регулюють вираження один одного [61,62]. Також були знайдені види, що кодують гомологи лише hFixL або FnrN. Rhizobium leguminosarum біовар viciae UPM791 містить два гомологи FnrN, але ні FixL, ні hFixL [81]. Невідомо, чи реагують два білки FnrN на різні O2 концентрації або діють надлишковим способом. Е. meliloti 1021 не містить гомолога FnrN, але добре вивчену систему FixLJ і, схоже, має гомологи hFixL і FxkR [82–84].

Щоб вивчити зв’язок між hFixL та FnrN, ми вивчили модельний організм Rhizobium leguminosarum біовар viciae 3841 (Rlv3841), який використовує обидва датчики (рис. 1) [85,86]. Rlv3841 має одну хромосому, імена генів якої починаються з RL, і шість мегаплазмід pRL7-12, назви генів яких починаються з, наприклад, pRL9. Основною симбіотичною плазмідою є pRL10, але багато симбіотичних генів також знайдено на pRL9, включаючи копію fixNOQP і fixGHIS оперон. Rlv3841 кодує дві копії hfixL, яку ми назвали hfixL9 (pRL90020 на pRL9) і hfixLc (RL1879 на хромосомі), з 54,9% ідентичності на рівні білка. Штам також містить два гомологи (58% ідентичності). fxkR, fxkR9 (pRL90026) і fxkRc (RL1881). Має три передбачуваних fixK гени, які ми позначили fixK (pRL90019), fixK (pRL90025) і fixKc (RL1880). The fixK і fixK а послідовності мають 53% ідентичності амінокислот fixKc має 38% і 47% ідентичності з цими білками відповідно. Обидва fixK-hfixL9 і fixKc-hfixLc здається, утворюють оперони (рис. 1B і 1D). Rlv3841 має одну копію fnrN (RL2818), регулюється двома анаеробоксами. Подібна подвійна анаеробоксова композиція існує в Rlv UPM791, де FnrN позитивно і негативно автоматично регулює власну експресію [87]. Індукує зв'язування FnrN з дистальним анаеробоксом fnrN транскрипція та зв’язування з проксимальним анаеробоксом пригнічує його. Також повідомлялося про автоактивацію FnrN Rhizobium etli CNPAF512 [88]. FixK регулювання fnrN експресія ймовірна, оскільки вона також зв'язує анаеробокси, але це не було досліджено.

Кисень показаний червоними діамантами. Білки показані у вигляді овалів, сайти операторів – у вигляді квадратів, а гени – у вигляді загострених прямокутників. Сайти початку транскрипції показані стрілками під прямим кутом. Закінчення рядків позначають активацію (стрілки), гальмування (тупий кінець) і трансляцію (круг). (А) Єдиний шлях, утворений двома датчиками, діє у два етапи. Стадія I починається в мікроаеробних умовах і може функціонувати поза вузликом. На цьому етапі hFixL активний, але FnrN ні. hFixL активує FxkR, який зв’язується з оператором K-box (помаранчеві квадрати «K»), щоб викликати вираз fixK. FixK зв’язується з операторами анаеробок (сині квадрати «А»), щоб викликати експресію, у тому числі перед fixNOQP (пунктирна лінія) і fnrN. Як тільки кисень у бактеріях досягає майже анаеробного рівня, FnrN стає активним і починається II стадія. Як і FixK, FnrN зв’язує анаеробокси. Він автоматично регулює fnrN як позитивно, так і негативно і спонукає fixNOQP вираз. (Б) Rlv3841 має кілька копій кількох генів регулювання кисню, і багато з них розташовані в кластери. На мегаплазміді pRL9, fixK утворює оперон з hfixL9, регулюється K-box. Цей оперон прилягає до fixNOQP9, регулюється анаеробоксом. (C) fixK і fxkR9 є суміжними, з анаеробоксом і К-боксом у своїй міжгенній області. (д) Хромосома Rlv3841 також має кластер, що містить fxkRc, fixKc і hfixLc. На відміну від подібних кластерів на pRL9, міжгенна область цього кластера не містить анаеробок або K-box операторів. (Е) fnrN ген не є частиною кластера і позитивно і негативно регулюється дистальним і проксимальним анаеробоксом відповідно. Детальні відомості про місце початку транскрипції, місця розташування анаеробоксу та K-боксу можна знайти у Таблиці 1.

Дослідження в R. leguminosarum VF39 виявив, що мікроаеробна експресія fnrN також вимагає RpoN [89]. Цей висновок не був повторений в інших місцях, і його значення залишається незрозумілим. Працювати в R. etli CNPAF512 це показав fnrN не контролюється RpoN у цьому організмі [88]. Rlv3841 кодує один передбачуваний rpoN ген (RL0422), але ми не знайшли сайтів зв'язування RpoN вище за Rlv3841 fnrN сайт початку транскрипції. Таким чином, RpoN не потрібен для fnrN вираз у Rlv3841.

Паралельне розташування hFixL-FxkR-FixK і FnrN в Rlv3841 призведе до надлишковості, тоді як розташування послідовно створить ієрархію між двома регуляторами. Тому наша мета - зрозуміти, як два датчики взаємодіють у Rlv3841, і дати уявлення про те, чому вони співіснують.


Анотація

Мікробне псування та харчові захворювання спричиняють значні економічні втрати та втрати продуктивності. Існує потреба в нових підходах і антимікробних обробках, щоб продовжити термін придатності продуктів, покращити якість та мікробну безпеку, зменшити псування та відходи, а також нові методи оцінки. Традиційні аналізи для перевірки токсичності протимікробних препаратів займають багато часу, трудомісткі, дають грубі оцінки токсичності і не можуть аналізувати складні зразки, такі як сирі харчові гомогенати. Використовуючи модельну протимікробну сполуку Lauroyl Arginate Ethyl Ester (LAE), ми описуємо нову аналітичну методологію, засновану на оптичному зондуванні кисню та респірометрії, для дослідження впливу різних антимікробних обробок на чисті бактеріальні культури, мікробіоту м’яса та упаковані зразки м’яса. Вимірюючи та аналізуючи часові профілі О2 зондового сигналу (тривалість життя фосфоресценції) в інкубаційних досліджуваних зразках нам вдалося візуалізувати токсичний вплив LAE на різні види бактерій, сформувати криві часу та реакції на дозу, розрахувати EC50 та час генерації досліджуваних організмів. Нова багатопараметрична платформа для тестування токсичності дозволяє проводити швидкий, автоматизований і паралельний аналіз кількох зразків у діапазоні концентрацій та умов антимікробних речовин.


Проектування та інженерія штамів метаболічних датчиків E. coli з широким діапазоном чутливості до гліцерату

Мікробні біосенсори використовуються для виявлення присутності сполук, що надаються ззовні або виробляються всередині. Останній випадок зазвичай обмежується необхідністю скринінгу великої бібліотеки ферментів або варіантів шляхів для визначення тих, які можуть ефективно генерувати потрібну сполуку. Щоб усунути це обмеження, ми пропонуємо використовувати штами метаболічних сенсорів, які можуть рости лише за наявності відповідної сполуки і таким чином замінити скринінг прямим відбором. Ми використовували обчислювальну платформу для розробки штамів метаболічних датчиків із різними залежностями від конкретної сполуки. Наш метод систематично досліджує комбінації делецій генів і визначає, як потреба в зростанні для сполуки змінюється залежно від складу середовища. Ми демонструємо цей підхід, побудувавши набір датчикових штамів гліцерату E. coli. У кожному з цих штамів порушується різний набір ферментів, так що центральний метаболізм ефективно розбивається на кілька сегментів, кожен з яких потребує спеціального джерела вуглецю. Ми знаходимо майже ідеальну відповідність між прогнозованою та експериментальною залежністю від гліцерату і показуємо, що штами можна використовувати для точного визначення концентрації гліцерату на двох порядках величини. Окрім демонстрації потенційного застосування штамів метаболічних сенсорів, наша робота розкриває ключові явища центрального метаболізму, включаючи спонтанну деградацію центральних метаболітів та важливість метаболічних стоків для балансування малих метаболічних мереж.

Ключові слова: Ауксотрофія Метаболічна модель на основі обмежень Вибір росту Синтетична біологія.

Авторські права © 2019 Автори. Опубліковано Elsevier Inc. Усі права захищено.


Реакторна техніка

13.4.8 Програмоване керування

Через властивий змінюваності у часі характеру періодичної ферментації та ферментації з підживленням підтримка постійного середовища або постійних значень метаболічних змінних не завжди є оптимальною стратегією контролю. Залежно від процесу зміни таких змінних, як рН і температура в критичні моменти, можуть підвищити швидкість виробництва та врожайність. Зміна швидкості корму має важливе значення при ферментації пекарських дріжджів із підживленням, щоб мінімізувати ефект Крабтрі та максимізувати виробництво біомаси. Швидкістю подачі також маніпулюють в кишкова паличка ферментації для зменшення синтезу побічних продуктів. При ферментації з вторинним метаболітом специфічна швидкість росту повинна бути високою на початку культури, але при високій щільності клітин потрібні різні умови для уповільнення росту та стимулювання утворення продукту. Подібні стратегії необхідні для оптимізації синтезу білка з рекомбінантних організмів. Експресії рекомбінантного продукту зазвичай уникають на початку культивування, оскільки зростання клітин негативно впливає, однак пізніше в серію додається індуктор для включення синтезу білка.

Для багатьох біопроцесів необхідна певна часова послідовність pH, температури, напруги розчиненого кисню, швидкості подачі та інших змінних, щоб розвивати культуру таким чином, щоб продуктивність була максимальною. Стратегія контролю, яка може врахувати різноманітні зміни змінних ферментації запрограмований контроль, також відомий як планування порційного ферментера. У програмованому управлінні політика управління складається з розкладу функцій контролю, які мають виконуватися в різні моменти процесу. Цей тип контролю вимагає детального розуміння вимог процесу на різних етапах і достатньо повної та точної математичної моделі системи.


МАТЕРІАЛИ ТА МЕТОДИ

Матеріали

Мікобактерії туберкульозу Геномна ДНК H37Rv була отримана від доктора Джеффрі Кокса з Каліфорнійського університету в Сан-Франциско. Ампіцилін був придбаний у Fisher Biotech, тоді як хлорамфенікол був отриманий від Roche, гемін від Fluka Biochemica, дитіоніт від JT Baker і IPTG від Promega. Лізоцим і фенілметилсульфонілфторид були від Sigma. Інгібітори протеаз (антипаїн, лейпептин та пепстатин), хлорамфенікол, систему ПЛР швидкого запуску з високою точністю та полімеразу Amplitaq були отримані від компанії Roche. 1 kbplus ДНК-драбину було придбано у Life technology. Аргон і CO були від Matheson Tri-Gas.

Simply Blue Safe Stain, In Vision Histag In-Gel Stain, Див. Білкові маркери Blue Plus 2, S.O.C. середовище разом з гелевим апаратом (Novex MiniCell), гелі NuPage 12% Bis-Tris і робочий буфер NuPage MOPS SDS були придбані у Invitrogen. The кишкова паличка Клітини XL-10 gold, BL21DE3 і XL-1 Blue були з Stratagene.

Набір для клонування TOPO TA був отриманий від Invitrogen і набір QuikChange Mutagenesis від Stratagene. Очищення ДНК проводили за допомогою наборів QIAgen. Рестрикційні ферменти, ДНК -лігаза Т4 і лужна фосфатаза були з New England Biolabs. Колонки HisTrap TM HP були отримані від GE Healthcare, тоді як діалізні трубки були придбані у лабораторіях Spectrum, Inc.

Плазміду pET23a+ придбали у компанії Novagen. Плазміду pTGroE люб’язно надав д-р Шунсуке Ішіі з Лабораторії молекулярної генетики Центру природничих наук Рікен Цукуба, Японія.

Праймери були розроблені з використанням програмного пакета GCG версії 10.3 для UNIX з Університету Вісконсіна. Індивідуальні праймери були синтезовані Invitrogen. Амінокислотний аналіз проводили в Каліфорнійському університеті в Девісі. Зразки ДНК були секвеновані в Каліфорнійському університеті в Берклі.

Клонування повнорозмірного DevS Gene

Ген DevS був ампліфікований з Мікобактерії туберкульозу Геномна ДНК H37Rv з використанням ПЛР PTC-200 Peltier Thermal Cycler від MJ Research та системи ПЛР Fast Start High Fidelity від Roche. А 10 хв. Початкова денатурація при 94 ଌ супроводжувалася 35 циклами: 94 ଌ 1 хв., 45 ଌ 1,5 хв, 72 ଌ 3 хв і 10 хв остаточне подовження при 72 Прямий праймер (GGATAGGGCATATGACAACAGGGGGCCTC) включав NdeI місце розщеплення, тоді як зворотний праймер (CCAAACGGGGATCCGAAGAGCTACTGCGACAAC) містив BamH1 сайт. Реакційна суміш містила 4% ДМСО. Продукт, отриманий у цій реакції, повторно ампліфікували, використовуючи ті самі умови, щоб отримати достатню кількість продукту ПЛР.

Клонування ТОПО ТА

3’ До очищеного продукту ПЛР додавали поліаденінові виступи за допомогою ДНК-полімерази Amplitaq. Реакцію клонування TOPO TA проводили протягом 30 хвилин при кімнатній температурі згідно з інструкціями виробника з використанням вектора pCR2.1-TOPO. Плазмідну ДНК очищали з кількох колоній клітин TOP10, трансформованих продуктом реакції клонування TOPO TA. Вставлення гена DevS було перевірено за допомогою рестрикційних дайджестів (або Нкоя або ніI) і правильна послідовність гена DevS була підтверджена секвенуванням ДНК.

Субклонування DevS642

Перші 642 bp, коди для N-кінцевого домену GAF, були ампліфіковані з використанням тих самих умов ПЛР та наступних праймерів: CCGCCGCCATATGCATCATCATCATCATCACGAGAACTTATATTTTCAAGGAATGACAACAGGGGGCCTCGTCGAC (прямий праймер, що містить 6-His-мітку та NdeI сайт розщеплення) і CGGACAAGCTTCTATTACGACTGACGCGCCTTAGCCTGCTG (зворотний праймер, який включає HindIII місце). Очищений продукт ПЛР розщеплювали з Ndeя і HindIII і лігований в pET23a+, розщеплений тими ж рестрикційними ферментами, а також лужною фосфатазою. Ультракомпетентні клітини золота XL-10 трансформували продуктом лігування. Після рестрикційного аналізу плазмідну ДНК також подавали на секвенування, щоб підтвердити правильну послідовність.

Мутагенез His149 з DevS642

Набір QuikChange Mutagenesis від Stratagene використовували для мутації His149 до аланіну згідно з інструкціями виробника. Використаними мутагенними праймерами були: CGATTGGTTTTCCGCCGTATGCCCCGCCGATGCGTACCTTCCT (прямий праймер) AGGAAGGTACGCATCGGCGGGGCATACGGCGGAAAACCAATCG (зворотний праймер). Конструкції були представлені на секвенування ДНК, щоб підтвердити правильну послідовність.

Вираз DevS642 та повнометражного DevS

Клітини BL21gold DE3 ко-трансформували за допомогою pET23a+DevS642 та pT-GroE. Клітини вирощували на планшетах LB, що містять як ампіцилін (50 бкг/мл), так і хлорамфенікол (34 бкг/мл). Потім п’ять заквасок засівали по одній колонії. Потім п’ять культур об’єднали та використали для інокуляції колб, що містять 1,5 л середовища LB, а також антибіотики ампіцилін (100 μg/ml) і хлорамфенікол (34 μg/ml). Клітини вирощували до оптичної густини OD600 0,8 при 37 ଌ і 230 об/хв. До індукції додавали гемін (45 мг/4,5 мл NaOH 0,1 N для кожної культури 1,5 л). Експресію білка індукували IPTG при кінцевій концентрації 1 мМ, і колби витримували при 18 ଌ протягом 20 годин. Клітини збирали центрифугуванням при 5000 об/хв протягом 25 хв. Крім того кишкова паличка BL21DE3, дві інші клітинні лінії були протестовані: Rosetta 2 і DH5α. Клітини DH5α не експресували бажаний білок, коли вони були трансформовані лише плазмідою, що кодує DevS642, або коли вони були ко-трансформовані, щоб також забезпечити комплекс GroEL/ES. Клітини Rosetta 2 також були протестовані, оскільки кілька кодонів меншого використання в кишкова паличка були ідентифіковані всередині гена. Було виявлено, однак, що рівень експресії не був значно підвищений. Повнорозмірний DevS клонували в pET23a+, використовуючи ту ж стратегію, що й у випадку білка wt DevS642. Повнорозмірний DevS коекспресували з комплексом GroEL/ES, а потім очищали в тих же умовах.

Вираз ApoDevS642

Була дотримана така ж процедура, що й для білка, зв’язаного з гемом, за винятком того, що i) гемін не додавали та ii) були зроблені додаткові кроки для видалення заліза та кобальту з культурального середовища. Для виключення солей кобальту з мінеральної суміші була використана опублікована процедура (23).

Експресія мутанта H149A DevS642

Мутант можна було експресувати як у вигляді білка, зв’язаного з гемом, так і як апопротеїну, дотримуючись методу, використаного у випадку wt DevS642. Для того щоб отримати апопротеїн, недостатнього додавання геміну було достатньо, і ніяких подальших кроків не було потрібно для зменшення забруднення рекомбінантним білком, зв’язаним з гемом. Апопротеїн мутанта H149A отримували з використанням середовища LB.

Очищення білка

Клітини лізували у фосфатному буфері рН 7,6 (50 мМ NaH2PO4, 10% гліцерину, 200 мМ NaCl, 1% Тритон Х-100, 0,5 мг/мл лізоциму, інгібітори протеази: протибольовий 1 μg/mL, лейпептин 1 μM, пепстатин 1 μM PM). Потім суміш інкубували зі струшуванням при 37 °C протягом 10 хв. Клітинні мембрани були порушені повторними циклами ультразвуку на 50% за допомогою сонячного апарата Бренсона 450 від VWR Scientific, при охолодженні на льоду. Нерозчинну фракцію виділяли центрифугуванням при 35000 об / хв протягом 1 години при 4 ଌ. Клітинний лізат наносили на колонку-пастку His об’ємом 5 мл зі швидкістю 1 мл/хв. Потім колонку промивали 20 і 50 мМ імідазолу у фосфатному буфері (50 мМ NaH)2PO4, 10% гліцерину, 500 мМ NaCl, 50 мл зі швидкістю 2 мл/хв). Рекомбінантний білок елюювали 200 мМ імідазолу у фосфатному буфері (50 мл, 1 мл/хв). Потім зразок діалізували і фракції, які не були чистими, повторно очищали на колонці-пастці His для отримання чистого білка. Ця процедура була успішною для гему, що містить wt DevS642 і H149A, а також для апопротеїну мутанта H149A. Буфер був замінений 20 мМ буфером Hepes (150 мМ NaCl pH 8) для виділення apoDevS642.

Кількісне визначення білка

Вміст білка для wt DevS642 визначали за допомогою амінокислотного аналізу в Каліфорнійському університеті, Девіс. Вихід розчинного білка становив 16 мг/л культури у разі спільної експресії з білками теплового шоку GroEL/ES. Вихід розчинного білка при його експресії без шаперонів становив 2,3 мг/л культури.

Визначення вмісту гему в Wt DevS642

Гідроксид натрію 5 N (5 μL) і піридин (18 μL) додавали до зразка білка (80 μL комплексу заліза). Записували окислений спектр, а потім додавали дитионіт натрію (кілька кристалів) для отримання зменшеного спектру. Поглинання при 539 і 556 нм використовували для визначення вмісту гему згідно з опублікованим протоколом (24). Вміст гему було визначено 97%.

Виключна хроматографія Wt DevS642

Олігомерний стан рекомбінантного білка DevS642 встановлювали за допомогою колонки Superdex 75 (FPLC) у фосфатній буферній системі (50 мМ фосфат, 200 мМ NaCl pH 7,6). Поглинання елюату контролювали на двох довжинах хвиль, 280 та 406 нм. Для визначення об’єму пустот використовували декстран (1 мг/мл). Калібрувальну криву було отримано з такими білковими стандартами: альбумін (MW 66000, 10 мг/мл), алкогольдегідрогеназа (MW 150000, 5 мг/мл), карбоангідраза (MW 29000, 3 мг/мл), цитохром c (MW 12400, 2 мг/мл). DevS642 є 96% мономерним (MW 30269, за оцінками аналізу гель -фільтрації) і 4% димерним (MW 61518).

Титрування геміном Wt ApoDevS642

Зразок білка 500 μL (як правило, 5 μM концентрація в Hepes 20 mM, NaCl 150 mM, 10% гліцериновий буфер) титрували розчином геміну. Aliquots of 0.5 μL of a 0.106 mg/mL hemin solution were added and the difference spectrum was recorded 10 min after each addition (the reference cuvette contained buffer and the same amounts of hemin.) To obtain the dissociation constant, 𹒫sorbance 407-350 nm was plotted as a function of hemin concentration and the data points in the titration were fit to the following equation: 𹒫sorbance = Aмакс/1 + Kд/[hemin] (25).

Cyanide and Azide Titrations of Wt DevS642

The concentration of DevS642 was determined based on the intensity of the Soret peak at 407 nm. A 500 μL sample (usual concentration 5 μM) was used in these assays. The initial spectrum of the protein in phosphate buffer (50 mM phosphate and 200 mM sodium chloride) was recorded and then difference spectra were acquired 5 min. after each addition (typically 0.5 μL) of the ligand to both the reference cuvette and the cuvette containing the protein solution. Sodium azide and potassium cyanide were prepared as aqueous solutions in the same buffer. The increase in absorbance at 424 nm (cyanide) or 422 (azide) was plotted as a function of ligand concentration and the data were fit to a rectangular hyperbola (the azide titration) or the quadratic tight binding equation in the case of cyanide (26).

Electronic Absorption and Resonance Raman Spectroscopy

Typical enzyme concentrations used were

100� μM. Biomax-10 ultrafiltration devices (Millipore) were used for buffer exchange and for concentrating the protein. Reduction to the ferrous state was achieved by adding microliter aliquots of 25� mM sodium dithionite solution to an argon-purged sample in the Raman capillary cell and was monitored by UV-visible spectroscopy directly in the capillary using a Cary 50 spectrometer. 12 CO (Airgas) and 13 CO (99% 13 C, ICON Stable Isotopes) adducts were obtained by injecting CO through a septum-sealed capillary containing argon-purged, reduced protein (

20 μL). О2 (Airgas), 18 O2 (99% 18 O, ICON Stable Isotopes), NO (Aldrich), and 15 N 18 O (98% 15 N and 95% 18 O, Aldrich) adducts were generated using the same procedure after excess dithionite was removed from the reduced sample with desalting spin columns (Zebra ™ 0.5 mL, Pierce). These procedures were performed in a glovebox with a controlled atmosphere of less than 1-ppm of O2 (Omni-Lab System, Vacuum Atmospheres Company). RR spectra were obtained using a custom McPherson 2061/207 spectrograph (0.67 m with variable gratings) equipped with a Princeton Instruments liquid N2-cooled CCD detector (LN-1100PB). Kaiser Optical supernotch filters were used to attenuate Raleigh scattering. A Krypton laser (Innova 302, Coherent) and a He/Cd laser (Liconix 4240NB) were used for the 413- and 442-nm excitations, respectively. Spectra were collected in a 90° scattering geometry on samples at room temperature. Frequencies were calibrated relative to indene and CCl4 and are accurate at ଑ cm 𢄡 . CCl4 was also used to check the polarization conditions. The integrity of the RR samples, before and after laser illumination, was confirmed by direct monitoring of their UV-visible spectra in the Raman capillaries.


Висновок

Complications in кишкова паличка-related infection have been mainly attributed to biofilm formation. Biofilm is considerably recalcitrant to antibiotics as compared to its planktonic culture. кишкова паличка biofilm formation is an intricate process which involves a number of steps such as initial adhesion, early development, maturation and dispersion. These steps are governed by a number of genes that serve specific functions in the formation of the biofilm. Type I fimbriae of кишкова паличка plays a crucial role in its attachment to the surface and maturation is further facilitated by autotransporters and EPS. Recent discoveries have also identified stress resistance genes in the biofilm-formation process that help the biofilm to survive in hostile environments. The rpoS gene is majorly responsible for regulating genes and structural proteins involved in the synthesis and degradation of biofilm, under stress conditions.

кишкова паличка biofilm has been found to be resistant to a number of antibiotics, mostly accredited to putative multidrug resistance pump. The development of the extracellular matrix and the observed increased resistance to common antibiotics create a challenge to control the infections caused by кишкова паличка biofilms. Recently there have been advances in exploring and developing new approaches and therapeutic methods to cure кишкова паличка biofilm-related infections.

Molecular and structural understanding of кишкова паличка biofilm has led to the advances in targeting specific agents to curtail infections. Type I pili of кишкова паличка are crucial for the adhesion and initiation of кишкова паличка biofilm formation. The curlicides and pilicides have been designed against curli subunit protein CsgA and type I pili, respectively, and have been shown to inihibit bacterial biofilm. The combination of phages have shown to complement lysis of bacteria through different mechanism of action and yielded promising results. Bacterial biofilm has been notorious in mounting resistance and phytochemicals and AMPs are able to address this issue through their diverse mechanism to target organisms.

One of the major problems faced by these remedial agents is stability and low bioavailability. Natural compound efficacy can be improved by incorporating them in nanoparticles or coating on a particular surface. Silver nanoparticles have shown great promise especially in coating the medical devices and wound dressings and were found to be effective against кишкова паличка biofilm both в пробірці і в природних умовах mouse model. An antimicrobial nanospray JUC, which was sprayed on a catheter was found to be efficacious in restricting кишкова паличка biofilm formation. These new methods hold a great promise but the issues concerning в природних умовах efficacy, toxicity and large-scale production need to be addressed before these potential therapeuticals can reach the clinical stage.


Подяки

We acknowledge funding by the Bundesministerium für Wirtschaft und Technologie within the framework of Zentrales Innovationsprogramm Mittelstand (ZIM). We also wish to thank Steffen Wagner and Stefan Ortleb for excellent technical assistance.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

Fig. S1 The influence of PFD immersion on the photosynthetic output of a sycamore leaf.

Fig. S2 The effect of the photosynthesis inhibitor DCMU on light-dependent oxygen production in the sycamore leaf.

Зверніть увагу: видавець не несе відповідальності за зміст або функціональність будь-якої допоміжної інформації, наданої авторами. Будь -які запити (крім відсутнього вмісту) слід направляти до відповідного автора статті.


Подивіться відео: Как это работает #10 Как проверить Датчик кислорода? Просто и понятно (Листопад 2022).